Printer friendly
Acronymfinder

What does MRP stand for?

MRP stands for Multidrug Resistance Protein


This definition appears very rarely and is found in the following Acronym Finder categories:

  • Science, medicine, engineering, etc.

See other meanings of MRP

Other Resources:
We have 336 other definitions for MRP in our Acronym Attic

Samples in periodicals archive:

Primer name Primer sequence homo Mdr1-F GTGTGGTGAGTCAGGAACCTGTA homo Mdr1-R TCTCAATCTCATCCATGGTGACA homo MRP1-F CCTCAGCATCTTCCTTTTCATGT homo MRP1-R TCCTGAGTCCCGTTGACGAT homo MRP3-F GGAGTCGCTTTCATGGTCTTG homo MRP3-R TGATGCGCGAGTCCTTCA homo MRP4-F CTTCTTCCCCTCAGCCATTG homo MRP4-R ACGGTTGCGCTGTGATATCTC homo MRP6-F TTAGACGCGAGAGGTCCATCA homo MRP6-R CGTATTGGATGCTGTCCTTTCC homo GAPDH-F ACACCCACTCCTCCACCTTT homo GAPDH-R TAGCCAAATTCGTTGTCATACC Mdr, muti-drug resistance gene; MRP, multidrug resistance protein.
In cancer cells, ABC transporters such as P-glycoprotein (P-gp; MDR1, ABCB1), breast cancer resistance protein (BCRP; ABCG2), and multidrug resistance protein 2 (MRP2; ABCC2), eliminate intracellular drug load by transporting substrates (including anthracyclines and taxanes) across the plasma membrane and out of the cell--preventing anti-cancer drugs from reaching their cellular targets [4,5].
Among their topics are using genetically engineered mouse models to study drug resistance in breast cancer, the flow cytometric evaluation of multidrug resistance proteins, drug ration- dependent antagonism as a new category of multidrug resistance and strategies for its circumvention, pharmaco-kinetic and pharmaco-dynamic implications of P-glycoprotein modulation, immuno-suppressors as multidrug resistance reversal agents, and overcoming multidrug resistance by RNA interference.
NASDAQ: ISIP) today announced the signing of a license and research agreement with investigators at Queen's University in Kingston, Canada, granting Isis exclusive worldwide rights to develop and market oligonucleotide therapeutics targeting a novel multidrug resistance protein (MRP).