Printer friendly
New search features  |  Acronym Blog
Google Toolbar button
Add to Google Home Page
Add Acronym Finder search to IE7
Free tools

Acronym Finder logo: click for home page
abbreviation to define
  

Examples: NFL, NASA, PSP, HIPAA, random
Word(s) in meaning: chat  "global warming"
Postal codes: USA: 81657, Canada: T5A 0A7

Save this page to del.icio.us  Save this page to Yahoo  Stumble It!  Digg this!  submit to Reddit  post to Facebook  add to Google Personal Home Page  add to your favorites/bookmarks

What does CO1 stand for?

Cytochrome Oxidase 1


Suggest new definition

This definition appears very rarely and is found in the following Acronym Finder categories:

  • Science, medicine, engineering, etc.

Other Resources:

Link/Page Citation...

<< PreviousAbbreviation Database SurferNext >>
Consent Order/Compliance Agreement
Croton Oil in Complete Freund's Adjuvant
Commercial Owned/Contract Operated
Contractor-Owned/Contractor-Operated
Colorado Electronics Benefits Transfer Service
Central Office/Head End (FONS)
Commanding Officer/Officer of the Deck
Commanding Officer/ Tactical Action Officer
Commanding Officer/Technical Director
Company/Team
Central Operations Specialist Firearms Command (formerly Specialist Operations 19; London, England, UK)
Carbon Dioxide
Consideration Of Others
Cytochrome Oxidase 2 (gene)
Carbon Dioxide Drench
Carbon Dioxide Equivalent
Chief Officers 3rd
Circle of Five (gaming, Dark Age of Camelot)
C Diminished Seventh (music)
Computer Ondersteuning Zevenaar

Samples in periodicals archive:
hongkongensis CACAGCTCACGCATCCCGGTCCAGC#(T)A 798 28sa1923r Saccostrea CACTTTCATTTCGCCTTTAGGTTTCGAAAG 923 28reverse All 1200 Cytochrome oxidase 1 (COI) gene COforward All COCar183r C.

Home  |  Help  |  About  |  What's New?  |  Suggest new acronym  |  Link to Us  |  Search Tools  |  Press
State Abbreviations  |  Partners  |  Contributors  |  Return Links  |  Statistics  |  Fun Buzzword Acronyms!  |  Read the AF Blog

All trademarks/service marks referenced on this site are properties of their respective owners.
The Acronym Finder is ©1988-2012, Acronym Finder, All Rights Reserved.  Feedback
Terms of usage   |  Licensing info  |  Advertising info  |  Privacy Policy  |  Site Map