Printer friendly
Acronymfinder

What does ABC stand for?

ABC stands for ATP-Binding Cassette


This definition appears very rarely and is found in the following Acronym Finder categories:

  • Science, medicine, engineering, etc.

See other meanings of ABC

Other Resources:
We have 1612 other definitions for ABC in our Acronym Attic

Samples in periodicals archive:

Primer sequence and reaction condition for the reverse transcriptase PCR Gene Primer sequences Annealing PCR temp ([degrees]C) product size (bp) FP: CAGACTCAATTTAGTGAG AAp63 RP: AGCTCATGGTTGGGGCAC 54 440 FP: AGTTCCATGGCACT000CATA ABCG-2 RP: TCAGGTAGGCAATTGTGAAGG 62 379 FP: CCTTCTTGCTGATCCAGTGGTAC Cnx43 RP: ACCAAGGACACCACCAGCAT 66 154 FP: GGCAGAGATCGAGGGTCTC K3 RP: GTCATCCTT000CTGCTGTAG 64 145 FP: CATGAAGAAGAACCACGAGGATG K12 RP: TCTGCTCAGCGATGGTTTCA 63 150 FP: GCCAAGGTCATCCATGACAAC GAPDH RP: GTCCACCACCCTGTTGCTGTA 63 498 [DELTA]Np63, delta Np63; ABCG-2, ATP-binding cassette, sub-family G (WHITE), member 2; Cnx43, connexin 43; K3, keratin 3; K12, keratin 12; GAPDH, glyceraldehydes-3-phosphate dehydrogenase Source: Taken with permission from Ref.
Genes involved in fatty acid synthesis, such as acetyl-CoA-carboxylase and elongation of long-chain fatty acids were reduced only by PCB-77 in corn-oil--fed mice, whereas lipid transport/export genes such as fatty acid binding protein 2 and 4, ATP-binding cassette A1, and apolipoprotein A-IV were altered in olive-oil--fed mice in response to PCBs.
The serine/threonine kinase Pim-1 promotes drug resistance mediated by the ATP-binding cassette multidrug resistance protein breast cancer resistance protein (BCRP, ABCG2) by stabilizing higher-order BCRP multimers